Evolucija

Šta su to mutacije?

Kratak pogled na osnove genetike

Da bi smo odgovorili na ovo pitanje, prvo moramo da znamo nešto o tome šta je genetski kod, i kako on funkcioniše. Ovo što sledi je kratak i veoma uprošćen uvod u najosnovniju genetiku...

U svakoj modernoj živoj ćelliji na svetu se nalazi centralni kontrolni sistem, zapis na osnovu koga ćelija funkcioniše, na osnovu koga se razmnožava, i koji kontroliše njeno ponašanje. Ovaj kontrolni sistem se sastoji od DNK, deoksiribonukleninske kiseline.

DNK sadrži informacije u vidu nizova baza: adenozina, timina, guanina i citozina, koji se najčešće označavaju skraćeno kao A, T, G i C. Nizovi ove četiri baze čine genetski kod, na osnovu koga život funkcioniše. Ovaj kod, kada se napiše slovima, obično izleda kao dugačak, besmislen niz slova: ATGCCTAAATCTG...

Na nekim mestima u ovom nizu “slova”, međutim, pojavljuju se specijalne oznake, obično u vidu posebnih sekvenci poznatih kao promoteri. Primer promotera je sekvenca ATG desetak baza nakon sekvence TATAAT. Ovakve specijalne sekvence označavaju aktivne delove DNK, poznate pod nazivom geni, i ti aktivni delovi su zaista važan deo celog sistema.

Ali kako se od gena, prostih nizova baza na DNK, dolazi do konačnog produkta, ćelije? Da bi smo ovo razumeli, moramo prvo da znamo još nešto o ćelijskoj hemiji. Ako zamislimo DNK kao “arhivu” u kojoj su pohranjene informacije o tome kako ćelija treba da radi i da se razmnožava, radnici koji obavljaju sav posao – čitaju informacije iz arhive, prave ćelije, dele ih, izvode sve procese koji su ćeliji potrebni da preživi – pripadaju drugoj klasi velikih molekula, poznatoj kao proteini.

Proteini su, po organizaciji, donekle slični DNK. Isto kao što je DNK lanac četiri osnovna sastojka koja se ponavljaju u različitim kombinacijama, proteini su lanci istih sastojaka...s tim što se proteini umesto četiri sastoje od dvadeset osnovnih delova, amino-kiselina. Svaka od ovih dvadeset amino-kiselina ima svoje posebne osobine, i njihove kombinacije omogućavaju proteinima da budu veoma fleksibilni i da obavljaju sve raznovrsne hemijske procese potrebne za opstanak života.

Svaki gen u okviru DNK sadrži informaciju o jednom određenom proteinu. Proteini nastaju na osnovu gena, i geni deluju tek kroz proteine napravljene na osnovu njih. Ako to razumemo, možemo da opišemo put od DNK do proteina:

Gen prvo prolazi kroz proces transkripcije. U ovom procesu, DNK lanac se razdvaja na dva dela, i jedna strana biva iskopirana u kraću sekvencu veoma slične kiseline, poznate kao ribonukleinska kiselina (RNK). Ovaj novostvoreni RNK lanac, za razliku od ogromnog lanca DNK, sadrži samo jednu informaciju: kako napraviti jedan određeni protein. Takodje, u lancu RNK, baza timin (T) biva zamenjena jednom drugom sličnom bazom, uracilom (U).

Nakon što je gen iskopiran u RNK, sledi proces translacije. RNK lanac odlazi do kompleksnog skupa molekula, ribozoma. Ribozom “čita” RNK lanac, i na osnovu RNK koda proizvodi novi protein. Pošto RNK, isto kao i DNK, ima samo četiri baze, potreban je određeni kod da bi se pomoću četiri slova mogao izraziti proteinski niz koji, setimo se, može imati bilo koju kombinaciju dvadeset amino-kiselina. Zbog ovoga, genetski kod je troslovan: svake tri baze u lancu RNK označavaju po jednu amino-kiselinu u novom proteinu.

Ovo je lakše razumeti na primeru. Zamislimo da se na DNK nalazi veoma kratak gen sa sledećom sekvencom:

ATGGTGCCTAATATTAGCTAG

Ovo će prvo kroz proces transkripcije biti prevedeno u RNK lanac sa sekvencom:

AUGGUGCCUAAUAUUAGCUAG

Ribozom će ovo citati tri po tri baze, i prevesti u niz amino-kiselina

AUG GUG CCU AAU AUU AGC UAG
Met Val Pro Asn Ile Ser Stop

Troslovne oznake (Val, Pro...) su simboli za određene amino-kiseline (valin, prolin...itd.). Zadnja tri slova, UAG, čine tzv. stop kodon, koji daje signal ribozomu da na tom mestu treba da prestane sa daljom sintezom proteina. Ova ilustracija pokazuje kako bi se od kratkog niza DNK mogao proizvesti kratak protein, koji onda može da obavlja nekakvu funkciju u okviru ćelije.

Za razliku od ovog našeg primera, naravno, stvarni proteini su daleko veći. Na primer, keratini, proteini od kojih su najvećim delom sačinjene naše dlake i nokti, su preko 300 amino-kiselina dugački, što znači da su geni na osnovu kojih su sačinjeni dugački više od 1200 baza. Najveći poznati protein, titin, se sastoji od neverovatnih 28000 amino-kiselina!

Šta su onda mutacije?

Mutacije su promene u genetskom kodu, do kojih može doći na mnoge načine. Svaki put kada se ćelija deli, recimo, DNK mora biti iskopirana u dve kopije, po jedna kopija za svaku novu ćeliju. Mada je ovo kopiranje veoma precizno, ono ipak nije savršeno – otprilike na svakih milijardu tačno iskopiranih baza, jedna biva pogrešno prenesena. Drugi izvor su oštećenja na DNK, do kojih može doći spontano kroz normalan život ćelije, ili kroz spoljne otrove ili negativne uticaje (ultraljubičasto zračenje, na primer). Kroz evoluciju, ćelije su razvile veoma kompleksan sistem za popravku promena na DNK, ali ovi sistemi ne samo što imaju ograničenja, već ponekad umeju da i sami izazovu dodatne greške.

KKonačno, jedna čitava klasa virusa, takozvani retrovirusi, igra veoma značajnu ulogu u mutacijama na DNK. Ovi virusi ne samo što inficiraju ćelije, već sadrže proteine zvane integraze, kkoji im omogućavaju da svoje gene upišu direktno na DNK same ćelije. Tako geni virusa postaju deo genetskog sklopa samog organizma, i mogu ostati u tom sklopu praktično zauvek.

Mada ovo na prvi pogled može izgledati kao nevažna stvar, bar što se genetike tiče, retrovirusi su u stvari igrali ogromnu ulogu u razvoju života na zemlji. Izgleda neverovatno, ali najveći deo ljudske DNK ne čine naši geni...već ostaci retrovirusa koji su se kroz milijarde godina integrisali u naš organizam, postajali neaktivni kroz mutacije, i prosto bivali kopirani iz generacije u generaciju zajedno sa aktivnim delom našeg genetskog koda. Najpoznatiji i najzloglasniji retrovirus današnjice je HIV, koji izaziva ljudsku imunodeficijenciju, poznatiju kao sida.

Postoje razne vrste mutacija, od kojih ćemo ovde radi ilustracije pomenuti dve osnovne varijacije.

Prva vrsta su takozvane point-mutacije, u kojima dolazi do promene jedne baze u genetskom kodu. Kao što će biti objašnjeno u daljem tekstu, ova vrsta mutacija ponekad ne izaziva nikakvu promenu u organizmu uopšte, ali ponekad može da bude veoma značajna. Primer pozitivne point mutacije je nedavno otkrivena point mutacija na jednom regulatornom genu, koja postoji u severnoj Italiji, među naslednicima čoveka kod koga se ona originalno dogodila. Ljudi koji nose ovu mutaciju imaju značajno manje šanse da dožive infarkt ili srčani udar, pošto se njihove arterije automatski čiste mnogo bolje nego kod ostalih ljudi. Primer negativne point mutacije su relativno česti problemi sa mutacijama na proteinu kolagenu, koje dovode do deformacija kostiju kod dece.

Druga vrsta su takozvane frejmšift (frameshift) mutacije, u kojima baza biva ubačena ili izbrisana. Ove mutacije su obično mnogo radikalnije od point-mutacija, pošto potpuno menjaju strukturu proteina.

Pogledajmo razliku između point i frejmšift mutacija na našem malom genu koga smo pomenuli ranije. Originalni gen izgleda ovako:

Gen:       AUG GUG CCU AAU AUU AGC UAG
Protein:   Met Val Pro Asn Ile Ser Stop

Zamislimo sada da se desi jedna point mutacija u kojoj jedan citozin bude zamenjen, recimo, adeninom. Rezultat će biti sledeći:

Gen:       AUG GUG ACU AAU AUU AGC UAG
Protein:   Met Val Thr Asn Ile Ser Stop

Point mutacija je promenila CCU, kod za amino-kiselinu prolin, u ACU, kod za amino-kiselinu treonin. Ovo može, ali ne mora, uticati na funkciju čitavog proteina.

Frejmšift mutacija na istom mestu, međutim, ima daleko veće posledice:

Gen pre mutacije:   AUG GUG CCU AAU AUU AGC UAG
Gen nakon mutacije: AUG GUG  CU AAU AUU AGC UAG
Citanje gena:       AUG GUG CUA AUA UUA GCU AG?
Protein:            Met Val Leu Ile Leu Ala ...

U ovom slučaju, citozin je prosto izbrisan iz genetskog koda...što je izazvalo da se sve kombinacije nakon toga (setimo se, ribozom čita kod tri po tri slova) promene. Sastav proteina nakon mesta brisanja je potpuno promenjen! I ne samo to, već je stop kodon, UAG, sada oštećen. Ako se u RNK nizu iza UAG nalazi još baza (za koje nije bilo predviđeno da budu prevedene), te baze će biti pročitane, i na osnovu njih će na protein biti dodato još amino-kiselina, što će dodatno promeniti njegovu strukturu i funkciju.

Zašto je većina mutacija neutralna?

Postoje dva osnovna razloga zašto je većina mutacija neutralna. Prvi od njih je što tri baze mogu da formiraju 64 različita koda, a pritom postoji samo dvadeset amino-kiselina. Rezultat ovoga je da više različitih kombinacija kodira istu amino-kiselinu.

Standardni genetski kod, koga prate skoro svi živi organizmi na svetu, je prikazan na slici ispod.

Kao što možete videti iz gornje tabele, neke amino-kiseline su kodirane samo jednim kodom (recimo, UGG je jedini kod za triptofan), ali većina ima tri, četiri, ili više kodova. Leucin, najčešća amino-kiselina, ima čak šest različitih kodova. Sa stanovišta mutacija, ovo ograničava njihov efekt značajno. Recimo, ako point mutacija proizvede promenu u genu iz CUU u CUC, to neće imati ama baš nikakav efekt, pošto oba kodiraju leucin, i proizvedeni protein će biti identičan.

Drugi razlog je fleksibilnost proteina. Sve amino-kiseline koje čine protein se mogu grubo podeliti u tri grupe. Prvo, tu je nekoliko ključnih amino-kiselina, koje učestvuju direktno u hemijskim reakcijama kojima proteini upravljaju, i koje se zato ne smeju menjati praktično uopšte. Drugo, tu su amino-kiseline važne za strukturu, koje mogu da se menjaju donekle, dogod promena nije preterano velika (po naelektrisanju ili po veličini). Treću grupu čine “slučajne” amino-kiseline, koje prosto povezuju prethodno pomenute dve grupe u niz odgovarajuće dužine, i koje se mogu menjati praktično bez ograničenja, a da pritom protein ostane funkcionalan.

U eksperimentalnim istraživanjima, naučnici su menjali i do 97% amino-kiselina u okviru nekih proteina, i uspevali da zadrže potpunu funkcionalnost.

 

[nazad na vrh strane]